Wednesday, July 31, 2019

An analysis of the poem ‘Monsoon History’ Essay

The poem is about the persona is reminiscing her childhood memories. It describes the persona’s â€Å"Peranakan† household during the monsoon season. In the â€Å"Monsoon History†, the lines are arranged in a particular way to create effect and the choice of words that the poet is focused on engaging the audience to interact with the poem. One of the themes of this poem is appreciating nature. The poem provides a vivid description of nature, which are the presence of creatures that are full of life, and the natural phenomena such as the monsoon. The monsoon is a period of uncertainties but when it is over there is tranquillity. We should learn to live by understanding the wonder of nature, even at times of uncertainties. The poet uses a lot of elements of nature and even small insects such as â€Å" gnats†, â€Å"black spiders†, †termites† in her poem. This shows that the poet is really observant of the things that are going around her and appreciating nature as she realised their peaceful co-existence. Furthermore, the persona faces the realities of life especially during the monsoon where the situation reflects uncertainties as indicated in stanza 2. The monsoon brings thunderstorm and rain, the atmosphere becomes moist. This is the reality of life in Monsoon History. One has to face this reality. Natural phenomenon in the form of the monsoon is in control and there is rolling darkness. The poem provides a realistic picture of what happens during the monsoon. The poem also highlights cultural richness. Traditions and customs are part of the culture practised by the people portrayed in the poem. There is a rich cultural heritage that needs to be preserved from generation to generation. This can be seen through strong presence of cultural sentiments that are symbolically presented this poem. For example, the poem provides some of the cultural practices such as the Nyonya-Baba tradition of wearing â€Å"sarong† and the burning of â€Å"silver paper† for the death. The â€Å"pantun† is also part of their culture and the â€Å"wash feet† is a taboo for them which symbolises whoever does not wash their feet before sleeping may have nightmares. The poem shows that people are identified through their cultural practices. The poet uses a lot of imageries which make our senses engage through the use of particular imagery in this poem. We as the readers feel the experiences as if we too are part of the experiences. For example, the auditory imagery such as â€Å"the air ticks† and â€Å"listening to down-pouring† are used to describe atmosphere. The poet also uses a lot of kinaesthetic as well as sight imagery by personifying animals, insects and the elements of nature in this poem. The use of words such as â€Å"air walking† and â€Å"fat white slugs furled† in this poem show actions and movement that makes the poem seem alive and engages our senses. The poem above is suitable to teach students for a reading lesson. For the pre-reading stage, teacher may ask students to work in pairs and share their childhood memories with their friends. They can talk about the foods, the clothes, the places that they used to eat, wear and go. This warm-up activity is helpful in activating students’ schemata and arousing their interests to analyse and understand the poem. As Aebersold and Field (1997) state, pre-reading is important to raise students’ awareness of the text that they are going to read later. After the warm-up activity students are usually ready to look at the poem. Therefore, as while reading activities, there will be two activities. First is the teacher introduces the poem to students. Teacher does a reading chain activity with students by asking the students to read one line each. Teacher may then ask students to get into group and discuss the elements such as the meaning, the themes and literacy devices of the poem as well as discuss the questions that are given to them by relating it to what they understand from the poem. By doing this activity, students may share their opinions and ideas. As a result, it may develop students’ interpretive skills. Lastly, as follow up activity at the post-reading stage, teacher may ask students to do a class project of Baba and Nyoya culture. Students are divided into four group: (1) Clothes, (2) beliefs, (3) traditions, and (4) background. In groups, they have to discuss, write and draw the ideas about Baba and Nyonya’s culture. Then, teacher compiles all the students’ work for the class magazine. This activity helps students to appreciate the poem more. In conclusion, Monsoon History is one of the good poems written by a famous Malaysian poet that has many good values to be taught to Malaysian students. Other than incorporating other type of literature such as British and American literature, Malaysian literature should also be embraced in education system seem they are appeal to students’ culture.

Tuesday, July 30, 2019

Equality of the Sexes: Elizabethan Era and Now

Equality of the Sexes: The Elizabethan Era and Now Equal rights have always been a major issue and dispute. Analysing the role of women in the Elizabethan Era, through Shakespeare’s representation in Romeo and Juliet, and comparing them to the role of women in the 21st century, will help to demonstrate that equality of the sexes has been achieved, and come a long way in the past 400 years. Three ways in which equality of the sexes has been achieved is the role of a married, and unmarried woman, and roles of women in society.Married women’s roles have changed significantly since the late 1500s. A dowry has been abolished when women get married. Their sole purpose of being has changed and is no longer to just provide and raise children and complete household tasks. They can now get a job and have rights in marriage and families much the same as men. In marriage, women had to have a child every two years, as childbearing was considered an honour even though it was potentia lly life threatening.Also in the late 1500s, women had to instantly obey their husbands and any other males in the family, and their punishment for not obeying was being beaten into submission. An example of this in Romeo and Juliet is when Juliet refuses to marry Paris, and Capulet calls her a â€Å"disobedient wretch† for not following (Act III, Sc. V, 160). In the 21st century, men can no longer legally chastise their wives and are not always considered the head of the marriage as they were in Shakespeare’s time.In Romeo and Juliet, Shakespeare has represented the roles of married women in the Elizabethan Era. In Act 1, Scene 1, Montague and Lady Montague arrive in the square where the fight is breaking out, Lady Montague tries to stop him, but has no control after attempting to hold him back, as she has no authority over him, he also demands that she give his sword to him in a very abrupt manner, â€Å"Give me my long sword, ho! † (Act I, Sc. I). Therefore, women’s roles in marriage have equalised over the past 400 years.The roles of unmarried women have also changed over the past four centuries. Unmarried women are now allowed to work, whereas the only alternative for unmarried women in Elizabethan times was domestic service, such as being a maid. Arranged marriages for unmarried women were very common in the Elizabethan period, as fathers wanted their daughters to marry somebody of a higher class to improve the family’s social status. Fathers liked to arrange a marriage as soon as sensibly possible, because unmarried women were looked upon with suspicion.In Romeo and Juliet, Lord Capulet arranges a deal with Paris about the marriage of Juliet when she was only 13. Capulet describes Juliet’s age, â€Å"†¦She hath not seen the change of fourteen years†¦ † (Act I, Sc. II, 9). Paris replies with, â€Å"Younger than she are happy mothers made,† (Act I, Sc. II, 12) which is representing the fact that women in the Elizabethan Era could be married and have children as young as 12. In a modern Western women’s world however, women no longer have arranged marriages and are allowed to choose their significant other.They are not looked upon with suspicion if they are unmarried, as it is very common in the 21st century, and women often don’t marry until around the age of 25 or older. In summary, an unmarried woman’s roles and rights have changed considerably since the Elizabethan period, and Shakespeare has conveyed an unmarried woman’s tradition through Romeo and Juliet. The roles of women in society have changed a sizeable amount since the late 1500s. In the Elizabethan period women had minor roles in society.They were raised to believe that they were inferior to men and that men were the leaders and women were the weaker sex. Shakespeare has represented women being the ‘weaker sex’ through a conversation between Gregory and Sampson, when Sampson states, â€Å"†¦ and therefore women, being the weaker vessels, are ever thrust to the wall†¦Ã¢â‚¬  (Act I, Sc. I, 20). Women were not allowed to go to school, but the wealthy were allowed to have private tutors, so they were highly educated, but the poorer families couldn’t get any education easily.They were not allowed to get jobs, and domestic service was their only choice. An example of this is the Nurse in Romeo and Juliet. In the 21st century however, women have a very significant role in society, with many even being political leaders and in important professions, such as lawyers, doctors, teachers and scientists. They also have political and rights in society the same as men. Therefore, a woman’s role in society has changed and equalised over the past 400 years.Since the Elizabethan Era, an unmarried woman's role, women's roles in society and their roles in marriage have changed significantly. Equality of the sexes has been achieved and com e a long way over the past 400 years. It is clear that this is true, through analysing an Elizabethan woman’s role and their portrayal in Shakespeare’s Romeo and Juliet, and comparing them to a 21st century woman’s rights and roles in marriage, society and being single or unmarried. Women’s rights have gradually equalised over the years, and someday, possibly, women will take over the world.

Monday, July 29, 2019

Best friends in our lives

Best friends in our lives Best friends are needed in life, and we all have them at some point in our lives. Some of us have had best friends that are imaginary, for some of us is mom, dad, or a family member, and for the rest a best friend is some stranger person that they meet along the way. For me, my best friend growing up was one of my younger cousins. He was 9 months younger but always acted like the oldest, toughest, and meanest one. We had a plan on what to do when we were old, we both dreamed on having a taco/Mexican restaurant. We both loved tacos and every Thursday after school we would go around the corner from his house and buy tacos from â€Å"Don Michael,† a super affordable place to eat where you would get way more than what you actually paid for. We were very closed and almost every weekend we wanted to sleep at each other’s house. After a few times staying at my house, he only wanted me to stay at his house, but he would not stay in my house for any reason. I thought it was a bit weird at first but I would always agree with him, and we would stay over at his house. One time, after several months of me constantly asking, he finally decided to stay in my house. Everything was going well and we were having a great time: eating a lot of food, candies, played video games, table games, playing soccer in the middle of the street, and watching movies. When it was time to sleep, we turned the lights off and the silent night began only to be torn apart with the noise of someone crying. At first I thought it was out side in the street, but as I listen closely and carefully I noticed the noise was coming form inside the house, inside my room. I quickly turned my light on and realized it was my cousin crying. â€Å"I havenâ€℠¢t done anything wrong, I haven’t said anything mean† I thought to myself. After a few seconds of crying with the light on he said he wanted to go home and see his mom. I was 8 years old and I had watched a lot of movies so I was thinking, â€Å"he must be sensing something, and we have to go see what’s going on with my aunt.† After having my parents drive for 45 minutes, we arrived at my aunt’s house and found out there was nothing wrong with my aunt and I started to wonder why my cousin was crying. A few years later, he agreed to stay over at my house again. The same thing happened over and over again so I knew that there had to be something wrong. It wasn’t until 6 years later when my cousin went to see a doctor and he was diagnosed with Schizophrenia. At the age of 17, I didn’t understand what that really meant and I wanted to help my cousin any way possible. Helping him was not very easy since my family and I had moved to a different country when I was 12. Living with schizophrenia doesn’t just take a toll on the person that has the disease but it also affects the family members. Managing it is not impossible and living a joyful long life could be very possible. Before covering the treatments and how to manage schizophrenia we will first discus what exactly is schizophrenia. Then, we will move on to the causes of the disease. Last, we will talk about the treatments and management of schizophrenia. Schizophrenia is a psychological disorder that involves severely distorted beliefs, perceptions, and thought processes. During a schizophrenic episode, people lose their grip on reality. They become engulfed in an entirely different inner world, one that is often characterized by mental chaos, disorientation, and frustration (CITE). According to Psychologytoday.com, there are at least 21 million people in the world that have Schizophrenia.

What is the Word Love Essay Example | Topics and Well Written Essays - 1000 words

What is the Word Love - Essay Example Love is something that individuals know from the very beginning. A mother whispering to an unborn baby is one of the first signs of love that a human is shown. From the beginning of an individual’s life, it is likely that love is the first feeling they feel. In the very beginning God created man. Man was alone. Since man was alone God loved man and he created a woman (Genesis 2:16) this woman allowed man to feel love. Love is one of the first feelings since the beginning of creation. The love between a man and a woman are one of the greatest feelings of love. Love between a man and woman produce an intimate and sexual form of love. These forms of love are what allow men and woman to want to become married to one another. Marriage is one of the oldest symbols associated with loving one another. Intimate and sexual forms of love allow individuals to become attracted to one another. This attraction allows chemicals in the brain to release endorphins that make people feel good. Th is feeling of good is all possible because of love. The love a man and woman share can lead to having children and raising a loving family. Love is something that is taught to children and carried with them their whole life. When a child is shown love, the child loves others and teaches that love to their own children. LOVE IN ACTION Children that are shown love from the beginning are more likely to love others. Loving others can be shown. Because of this, love is so much more than just a word defined in the dictionary. Love is an action. Love as an action is amazing. There are so many ways to show love as an action. People show love everyday as an action. From infants to adults, people are able to show love. Babies show love by crying when someone they love walks away. The babies cry because they love that person and do not want to see them go. Children love in action when they hug someone else that they see hurt. They hug to show that they love. Teenagers show love as an action wh en they experience there first kiss. That first kiss is a sigh of love. An adult bringing home a bouquet of flowers is showing love as an action. Love in action is without a doubt amazing. Love can be shown by picking up the phone and calling an old friend. Love can be shown by hanging up a photo of someone who is missed. People perform these actions because of love. No other emotion would show such an experience. This is why love is an experience in itself. Although love is able to show actions that are pleasing, love can also show actions that may be tough and hurtful at times. A parent may discipline a child because of a tough form of love. Love as a tough action is important for all individuals. Being shown tough love can allow someone to learn and gain from the experience. When someone close does something that seems hurtful at the time, it is likely because they love. Doing things that may not seem right are necessary to prove a point. An individual would not bother proving th e point if it was not for love. Love can also cause intense and inappropriate actions of love.  Ã‚  

Sunday, July 28, 2019

English 305 Essay Example | Topics and Well Written Essays - 750 words

English 305 - Essay Example al. 67). Broadly, the types of criminal activities handled by the Wood vale sub-federal police department include the following; robbery with violence, domestic violence, carjacking and pick pocketing among other petty criminal offenses. Robbery with violence was rampant with 34% reported cases in the first quarter of the year in the months of January through to march. In the criminal investigating department, this was due to police departments’ leniency in the first quarter months to tackle robbery with violence criminal activities. In the second quarter in the months of March through to June, the robbery with violence cases reduced to 17% (Conser et. al. 91). This was because of stringent rules and regulations by the police department, which were aimed at reducing this criminal act. Domestic violence was also at a higher percentage at the beginning of the year. This, however, has reduced in the second quarter due to the adoption of the community policing policies. Psychologically and socially, the domestic violence criminal activities are more inclined towards the communities’ policing hence it was a good idea for the police department to take part in the community related criminal control mechanisms . Carjacking criminal activities have reduced from 54% to 30% while pick pocketing has reduced from 43 to 22 percent. The Woodvale groove region is a place in the woodlands thus most of the car robbery incidences are often carried out in this region. The inaccessibility nature of this area perhaps makes it easier for the car robbers to maneuvre their way into the woodlands. As the police department, over the second quarter of the year 2014, we engaged in various highway traffic operations. These operations aimed at the identification of cars and their ownership. These operations have reduced carjacking incidences. Lastly, pick-pocketing incidences have also reduced by 21 percent in the second quarter months of the year

Saturday, July 27, 2019

Assignment 5 Example | Topics and Well Written Essays - 250 words - 10

5 - Assignment Example Everyone has got a story to tell. The narrator talks gently about his present wife Laura whose affection he worships, and it is evident in the attention he gives to subtle gestures and touches between them. Terry`s story about her past lover who wanted to kill her out of jealousy serves as the reason of the arguments on the subject of love. While Terry insists that wanting to kill someone and dying for someone is still love her present husband Mal denies her point of view. However, he is also puzzled by the phenomenon of love when he wonders where all the love between him and his first wife gone. Now he wishes her to get married or to die. When people talk about love they talk about death as well because these two concepts are inseparable. That is why the story about an elderly couple touches everyone as Mal tells in agitation of a man who being injured very badly was depressed only because he could not see his wife. Probably, in this context the dreams about knights look very extrao rdinary. However, the quote that touched me and helped me to grasp the message of the story was about knights. When Mal expresses his desire to be a knight he understands how easy it was to die in those times though there were no cars and

Friday, July 26, 2019

Review Assignment Example | Topics and Well Written Essays - 250 words

Review - Assignment Example decisions in terms of using the environment in a way that it will be protected from degeneration and pollution which if they would occur would leave the ecosystem in a state that would not support future generations. It entails proper use of resources in order to ascertain that there is continued existence of natural resources, whereby people are required to use resources in a way that they ensure their actions have reduced or no negative impact on the environment. The three videos put emphasis on how people should make it their sole aim to protecting the environment to support humanity into the future. The videos explain that to be able to make the environment sustainable for human life into the future, it is the duty of everyone to ascertain that their actions are in line with the goal of environmental sustainability. I think that the videos are viable in that they explain why humans need to protect the environment through responsible practices so as to ensure that natural resources remain in existence and there is minimal pollution. Sustainability will ensure that humans have access to clean water, food and fresh air, which will be achieved if humans do not become a threat to their way of life by polluting the environment (Igloo

Thursday, July 25, 2019

Is It Cheaper to Keep Inmates on Death Row or Execute Research Paper

Is It Cheaper to Keep Inmates on Death Row or Execute - Research Paper Example This essay will be outlining the varying opinions and suggestions for the arguments. One reason why it is cheaper to keep inmates on death row for life imprisonment than to execute them is because of the number of appeals that take place by the yet to be executed inmates. During the appeals, the tax payers bear the cost of hiring lawyers, which, when calculated, comes up to millions of dollars. In comparison, in case a person is imprisoned for life, the costs of maintaining the convicts can only run from 15-25 thousand dollars annually, which is approximated to be about one million after a period of 40 years. The costs of retaining a lawyer is more severe when the crime committed is a capital case, hence it will consume an amount of legal and maintenance fees. This is because the cases can take 20 years or more before any verdict is reached, which accumulates and adds up to the sum of maintenance which is hard with the worsening economic conditions (Trevor, 136). Another key reason w hy capital punishment like execution is being discussed and discouraged is the risk of convicting an innocent person. Majority of the convicts have been found to be innocent after DNA tests have been carried out. The costs of carrying out appeals are expensive as majority of the lawyers who handle such cases are well recognized and experienced, and they would require large sums of money to be hired. In some places in Texas, United States, it is difficult to find lawyers who will take up other cases as they view some of the cases as non- lucrative. This is despite the fact that statistics show that if one hires a good lawyer the chances of being sentenced to death are considerably less (Mutual, 165). Other costs that accrue from executions include costs resulting from a number of DNA tests, costs of relocating inmates into specialized segregated rooms as well as costs of hiring and training specialized guards to look after the inmates. Statistics in Europe have shown that the number of death sentences in the continent have gone down by 7% in 1999 to 15% in 2008, the reason being that a second chance can be achieved during life imprisonment. In addition to the complex appeals, procedures and tasks, a person who is well convicted has another chance or possibility of repeatedly applying for pardons which then adds up to the excessive appeals procedures. It has also shown that prosecutors in Dallas County have stopped asking for death penalties, instead they are requesting life in prison with the possibility of being pardoned after a period of 40 years. It is estimated that a return to execution rate of six per year would cost approximately 90 million dollars annually (Michael & Borg, 62). However, other people have a different view, arguing that death penalty is the only sure and open way to clearly indicate that justice has been done. They state that even though the case may take longer and large costs might be encountered, eventually justice will be accomplished . In support of this, a pro-capital punishment group led by Kent Scheidegger argues that if an effective appeal is brought, the whole process then must cost less and eventually justice can be obtained in the shortest time possible. The only way was to revamp the appeal process to take place more quickly so that the inmates need not spend more of their years before execution can take place (Hans, Klas & Villian, 56). According to California crime statistics, its appeal system produces a wait of about 20

Wednesday, July 24, 2019

Counseling (Exisential Therapy) Essay Example | Topics and Well Written Essays - 750 words

Counseling (Exisential Therapy) - Essay Example In the spiritual approach, a transcendent answer to the four themes is believed to exist. In the atheistic approach, it is believed that there is no answer to the four major questions. One thing that is for certain for a human being is death. There is no denying it. But one cannot move forward in life if the person if afraid of death. The awareness of a person's life being limited by death can cause anxiety. But ignoring the presence of death in a person's lives will not help either. One will have to use the knowledge of the limitation of life to the best advantage for succeeding in life. Dr. Hoffman states that a person who finds the balance between the awareness of death and finding strength not to get overcome by it will have better chance of leading a fulfilling life (Existential Therapy, http://www.existential-therapy.com/General_Overview.htm). Freedom and Responsibility always come together. When people try to enjoy their freedom while ignoring their responsibilities, chances are that psychological consequences like depression, anger and anxiety starts to occur. Every person is free to choose their path in life, but at the same time he or she should take full responsibility of the outcome. One should never blame another human being for anything that happens in life. This also means that one should never let any belief or organization take charge of their lives. Also one should have the awareness that he or she is not powerless in any situation, either natural calamities, or diseases, or oppression, that he or she is responsible for themselves and the predicament there are currently in. Isolation Throughout one's life, a person is involved in different relations with all the people around him. In doing that the person might try to have a hold in the other person's life. But one needs to realize that human beings are essentially alone in this world. One needs to find validation from within, not from others. This awareness will make one live life more to the fullest than live thoughtlessly (Existential Therapy, http://en.wikipedia.org/wiki/Existential_therapy). Meaninglessness The human life can be described as a journey to find the meaning of life or a journey to create a meaning for life. When one thinks about the human life in terms of the isolation it faces, it might appear meaningless to stay alive. It is now that the urgency of creating one's own values and find or create own meanings for life becomes apparent. This will give the person a feeling of significance and will make the person strong enough to uphold the newly found meaning through life. The Therapy Existential Therapy when applied to real life situation can be viewed from four different angle, they are; the view of man, the goals of therapy, the role of the therapist and the role of the client. The view of man Man being a social animal longs to connect with others and might try to find

Tuesday, July 23, 2019

Quasi-Experimental Designs Essay Example | Topics and Well Written Essays - 250 words

Quasi-Experimental Designs - Essay Example S., (1992). Sex Differences in Performance on the Mathematics Section of the Scholastic Aptitude Test: A Bidirectional Validity Study. Harvard Educational Review. Vol. 62(3), pp. 323-337. Reason for choice: Studies like these are part of classic literature on abilities and on psychological testing. The study also provides support for the urban legend that boys (males) are better at mathematics as compared to girls (females). This study also provides a perfect example for understanding quasi-experimental designs, since the selection of subjects in each group can be randomised perfectly; but the actual manipulation of the Independent variable is impossible. Variables: The independent variable for this study is the sex of the participant, and the dependent variable is the score obtained by the participant on the mathematics section of the SAT. Alternate research design: The same study results would be more valuable if the effect of study background was removed. This can be done by using a measuring the extent to which the subject has studied mathematics or mathematics dependent subjects in the two years before giving the exam; and then removing the effect of this variable from the data by using an Analysis of Co-Variance.

Nursing Philosophy Essay Example for Free

Nursing Philosophy Essay Introduction Philosophy originates with the Greek word philosophia, which translates as the love of wisdom. Philosophers are engaged in inquiry concerning the search for truth, the nature of universe and the meaning of human experience. Welch Polifroni(1999). The aim of this paper is to compare and contrast the philosophical paradigms of Realism, Antirealism, Phenomenology , Postmodernism. To relate the Empiricism, Positivism, Historicism, and Relativism to the nature of scientific truth. Moreover, to discuss the significance of truth for nursing as a profession and as a science. The various paradigms are characterized by ontological, epistemological and methodological differences in their approaches to conceptualizing and conducting research, and in their contribution towards disciplinary knowledge construction. Weaver, and Olson. (2006). Table 1 illustrate theses differences between these philosophical paradigms. Realism and Antirealism Realism has an ontology which states that the structures creating the world cannot be directly observed. Its epistemology is that appearances do not necessarily reveal the mechanisms which cause these appearances, and its methodology therefore  involves the construction of theories which can account for these appearances. Wainwright,S. ( 1997). Realism, in the Aristotelian, holds that things and individuals have existence independent of human thought and that this extra-mental world is intelligible and forms a basis for evaluating propositions about the world. Whelton,B. (2002) 2 Philosophy course –First Assignment Positivism collapses the world into a single plane of events. In contrast, realism recovers the ontological depth between the three stratified domains and thereby establishes relations of natural necessity rather than the relations of logical necessity  (universality). Wainwright,S. ( 1997). Relevance of Realism to Nursing Realism proposes a common ontology and epistemology for the natural and social sciences. Realism enables the traditional natural and social science division in subjects like geography, psychology, medicine and nursing to be bridged. Realism can therefore provide ontological and epistemological basis for nursing. Wainwrigh( 1997). On the other hand, the interest her in the causal and epistemological ingredients of scientific realism because they support the claim that explanations are important in nursing science  and practice and that the aim of scientist is to discover better and better explanations. Gortner, and Schumacher,(1992). Relevance of Antirealism to Nursing It the positivist antirealism that make their views inappropriate for nursing science. It is not possible in positivism to deal with subjective aspects of person, nor with perceived relational processes, nor with explanations without translating them into physiological states or behaviors. One of the most serious consequences of an antilrealist construction of theories is that theories cannot explain. One of the major distinction  between scientific realism and antirealism is the way in which theoretical entities are understood. In the language of scientific realism the term theoretical entities usually means unobservable entities, states, or processes. The antirealists deny the existence of 3 Philosophy course –First Assignment unobservable entities or process. Antirealist assert that the notion of truth or falsity is relevant to observation even though it is not relevant to theory. Gortner, and Schumacher,(1992). Phenomenology For Edmund Husserl, phenomenology is the reflective study of the essence of  consciousness as experienced from the first-person point of view Phenomenology, founded by Edmund Husserl, promotes the idea that the natural world is largely shaped by the human mind. Wikipedia, (2007). Phenomenology is philosophical movement whose primary objective is the direct investigation and description of phenomena as consciously experienced. It remains different from and in opposition to positivism because it is a theoretical, non causal, and attempts to be free of supposition. Welch(1999) P243). Postmodernism The essence of truth lies within the individual and the individual may change or  later alter that view dependent on the context and the circumstances. Thus, the postmodern worldview is that truth neither singular nor multiple; it is personal and highly individualized and contextually driven. Welch Polifoni (1999)p-58) The Significance of Truth for Nursing as a Profession and as a Science. Science, philosophy and philosophy of science are all topics of great significance to nursing†¦the need to examine issues of what it means to know, what truth is, how we know and what can be learned from science and philosophy is central to growth in the 4 Philosophy course –First Assignment  discipline. Simultaneously, it is imperative that nurse scholars gain understanding of the divers scientific and philosophic traditions that have influenced the development of nursing knowledge in order to develop and enhance our science, our discipline and our profession. †. Welch and Polifroni (1999(p-1)) Philosophy of science in nursing seeks to understand truth, to examine prediction, causality and law, to critically relate theories, models and scientific systems. Theses goals are accomplished through the methods of philosophic inquiry of reflection and dialogue. Welch Polifroni(1999(p-5)). In order to understand what truth is, Welch Polifroni(1999) discussed the sources of truth ( Intuition, Authority, Tradition, Common Sense and Science)as well as the theories of truth such as correspondence theory; coherence theory; pragmatic theory; semantic and performative theory. These theories gave different interpretations for truth, for instance, correspondence theory suggests that truth is related to and correspond with reality, the truth is achieved through perceptions of the world, on the other hand for coherence theory, the truth is true if it is coherent while for the pragmatic theory the  truth is relative and related to the practicality and workableness of a solution. According to Newman, Sime and Corcoran-Perry(1991):’’ Nursing is the study of caring in the human health experience†¦nursing body of knowledge includes caring and human health experience. A body of knowledge that does not include caring and human health experience is not nursing knowledge. †. Truth can be achieved through knowing principles and causes of the natural kind behind phenomena. It is proposed that humans are the natural kind behind nursing phenomena. Thus, human nature provides proper principles (the truth) of nursing 5  Philosophy course –First Assignment practice†¦. It is proposed that it is knowledge of human nature that provides principles of human action, and thus human nature is a source of practical truth in nursing. Whelton . (2002). The realist ontological position assumes that an objective world exists independently of our knowledge, beliefs , theories or descriptions about it. This reality exists whether or not we can experience it or have conceptions of its nature. In contrast, several nonrealist positions have also been advanced, incorporating a wide variety of philosophical views pertaining to truth. These positions reject ontological and/or  epistemological realism, and therefore truth cannot be related to an external reality . Lomborg and Kirkevold (2003). However, Gortner and Schumacher (1992 )stated that ‘’ Nursing scholars can explore scientific realism for the insights it may provide for nursing science â€Å". Moreover, Gortner and Schumacher (1992) proposed that â€Å" Scientific realism is relevant to nursing science in the following ways: (1) It supports the full range of nursing theory; (2) It affirms the importance of including subjective client states in nursing theory and refutes the claim of the positivists that if it is not observable, it does not exist. ;(3) It adds the idea of the substantive content of explanations to discussion about forms of explanation;(4) It includes the notion of truth as a regulative ideal in science and claims that better theories are theories that are closer to the truth†. 6 Philosophy course –First Assignment Relate the Empiricism, Positivism, Historicism, and Relativism to the nature of scientific truth Positivism Positivist approaches are founded on an ontology that the things we experience are things that exist. Its epistemology requires that this experience is verified through the  deductive methodology of the `scientific method Wainwright,S. ( 1997). The positivistic philosophy of science will for example argue that scientific knowledge is objective and should be verified accordingly. Nyatanga(2005). The Relevance of Positivism to Nursing : It the positivist antirealism that make their views inappropriate for nursing science. It is not possible in positivism to deal with subjective aspects of person, nor with perceived relational processes, nor with explanations without translating them into physiological states or behaviors. One of the most serious consequences of an antilrealist  construction of theories is that theories cannot explain. Gortner, and Schumacher, (1992). EMPIRICISM Empiricism in its classical sense was a philosophical doctrine that considered observation to be the foundation of knowledge. Gortner and Schumacher(1992). Contemporary empiricism is a paradigm that has the ability to facilitate the application of the scientific facts learned from empirical methods within the appropriate context by taking interpretative knowledge into account†¦ It thus seems apparent that a broader view of scientific knowledge is required, and this is where contemporary views of 7  Philosophy course –First Assignment empiricism are more applicable to the practice of nursing. However, before reviewing the basic tenets of contemporary empiricism, there is a need to provide an overview of interpretive methods and their ability to provide a context or structure for the use of empirical knowledge. Pluralism supports the assumption of contemporary empiricism that human responses can be identified, measured and understood even considering their complex nature. Therefore, an important part of nursing knowledge acquisition includes a synthesis of the data in order to better understand the  synergistic effects of the whole, which cannot be learned simply by studying its parts. Traditional empiricism provides a basis for the study of certain types of knowledge that have made important contributions to the science of nursing. Giuliano,K. ( 2003) The strength of contemporary empiricism is that it values traditional empirical knowledge but takes interpretive knowledge into account in order to provide a context for the appropriate application of that knowledge. The pluralistic nature of contemporary empiricism gives it the ability to bridge the gap between the facts of scientific  knowledge and the use of scientific knowledge in order to facilitate the application of all types of nursing knowledge. Giuliano,K. ( 2003). HISTORICISM The main protagonist of historicism is Kuhn. He was dismayed to find that traditional accounts of the philosophy of science bore no comparison with historical 8 Philosophy course –First Assignment evidence. He then set out to establish a theory of the philosophy of science in keeping with historical evidence as he saw it (hence the term historicism). Nyatanga (2005). Relativism Epistemological relativism view of truth and falsity in general are relative. An epistemological relativist denies that anything at all can be known with certainty. According to hard core epistemological relativism, everything is a matter of opinion, including science. In this view of truth, nursing science has much knowledge that is derived from opinion and personal experience and consequently it is relative knowledge. Summary The importance and significance of the philosophical world views of realism, antirealism, phenomenology , postmodernism, positivism, empiricism, relativism and historicism for nursing science and profession were explored in this paper. However, this  area need more detailed exploration through our philosophy course in order to understand the similarities and differences between these philosophical worldviews and how we can integrate this knowledge in our practice and education. 9 Philosophy course –First Assignment References Giuliano,K. (2003). Expanding the use of empiricism in nursing: can we bridge the gap between knowledge and clinical practice? Nursing Philosophy. 2003,4, pp. 44–52. Gortner,S. and Schumacher,K. (1992). (Mis)conception and Reconceptions about Traditional Science. Advances in Nursing Science, 1992, 14(4):1-11 Lomborg,K. and Kirkevold,M.(2003). Truth and validity in grounded theory – a reconsidered realist interpretation of the criteria: fit, work, relevance and modifiability. Nursing Philosophy, 2003,4, pp. 189–200. Newman,M. , Sime, A. , and Cororan-Perry. .(1991)The Focus of the Discipline of Nursing. Advances in Nursing Science,(1991),14(1)1-6. Nyatanga, L. (2005). Nursing and the philosophy of science. Nurse Education Today (2005) 25, 670–674 Wainwright, S. ( 1997). A new paradigm for nursing: the potential of realism. Journal of Advanced Nursing, 1997, 26, 1262-1271 Weaver, K. and Olson, J. (2006). Understanding paradigms used for nursing  research. Journal of Advanced Nursing 2006 Vol. 53 Issue 4 pages 459–469 10 Philosophy course –First Assignment Welch,M. and Polifoni,E. (1999) . Perspectives on Philosophy of Science in Nursing. An Historical and Contemporary Anthology. Copyright 1999. Lippincott Williams Wilkins . Whelton,B. (2002) Human nature as a source of practical truth: Aristotelian–Thomistic realism and the practical science of nursing. Nursing Philosophy,2002, 3, pp. 35–46 Wikipedia, (2007). Phenomenology. Wikipedia the free encyclopedia. Retrieved October 15, 2007, from http://en. wikipedia. org/wiki/Phenomenology.

Monday, July 22, 2019

A Brief History of English and American Literature Essay Example for Free

A Brief History of English and American Literature Essay The Norman conquest of England, in the 11th century, made a break in the natural growth of the English language and literature. The old English or Anglo−Saxon had been a purely Germanic speech, with a complicated grammar and a full set of inflections. For three hundred years following the battle of Hastings. this native tongue was driven from the kings court and the courts of law, from parliament, school, and university. During all this time there were two languages spoken in England. Norman French was the birth−tongue of the upper classes and English of the lower. When the latter finally got the better in the struggle, and became, about the middle of the 14th century, the national speech of all England, it was no longer the English of King Alfred. It was a new language, a grammarless tongue, almost wholly {12} stripped of its inflections. It had lost a half of its old words, and had filled their places with French equivalents. The Norman lawyers had introduced legal terms; the ladies and courtiers, words of dress and courtesy. The knight had imported the vocabulary of war and of the chase. The master−builders of the Norman castles and cathedrals contributed technical expressions proper to the architect and the mason. The art of cooking was French. The naming of the living animals, ox, swine, sheep, deer, was left to the Saxon churl who had the herding of them, while the dressed meats, beef, pork, mutton, venison, received their baptism from the table−talk of his Norman master. The four orders of begging friars, and especially the Franciscans or Gray Friars, introduced into England in 1224, became intermediaries between the high and the low. They went about preaching to the poor, and in their sermons they intermingled French with English. In their hands, too, was almost all the science of the day; their medicine, botany, and astronomy displaced the old nomenclature of leechdom, wort−cunnin g, and star−craft. And, finally, the translators of French poems often found it easier to transfer a foreign word bodily than to seek out a native synonym, particularly when the former supplied them with a rhyme. But the innovation reached even to the commonest words in every−day use, so that voice drove out steven, poor drove out earm, and color, use, and place made good their footing beside hue, {13}wont, and stead. A great part of the English words that were left were so changed in spelling and pronunciation as to be practically new. Chaucer stands, in date, midway between King Alfred and Alfred Tennyson, but his English differs vastly more from the formers than from the latters. To Chaucer Anglo−Saxon was as much a dead language as it is to us. The classical Anglo−Saxon, moreover, had been the Wessex dialect, spoken and written at Alfreds capital, Winchester. When the French had displaced this as the language of culture, there was no longer a â€Å"kings English† or any literary standard. The sources of modern standard English are to be found in the East Midland, spoken in Lincoln, Norfolk, Suffolk, Cambridge, and neighboring shires. Here the old Anglian had been corrupted by the Danish settlers, and rapidly threw off its inflections when it became a spoken and no longer a written language, after the Conquest. The West Saxon, clinging more tenaciously to ancient forms, sunk into the position of a local dialect; while the East Midland, spreading to London, Oxford, and Cambridge, became the literary English in which Chaucer wrote. The Normans brought in also new intellectual influences and new forms of literature. They were a cosmopolitan people, and they connected England with the continent. Lanfranc and Anselm, the first two Norman archbishops of Canterbury, were learned and splendid prelates of a {14} type quite unknown to the Anglo−Saxons. They introduced the scholastic philosophy taught at the University of Paris, and the reformed discipline of the Norman abbeys. They bound the English Church more closely to Rome, and officered it with Normans. English bishops were deprived of their sees for illiteracy, and French abbots were set over monasteries of Saxon monks. Down to the middle of the 14th century the learned literature of England was mostly in Latin, and the polite literature in French. English did not at any time altogether cease to be a written language, but the extant remains of the period from 1066 to 1200 are few and, with one exception, unimportant. After 1200 English came more and more into written use, but mainly in translations, paraphrases, and imitations of French works. The native genius was at school, and followed awkwardly. The Anglo−Saxon poetry, for example, had been rhythmical and alliterative. It was commonly written in lines containing four rhythmical accents and with three of the accented syllables alliterating. R_este hine thà ¢ r_à ºm−heort; r_à ©ced hlifade G_eà ¡p and g_à ³ld−fà ¢h, gà ¤st inne swà ¤f. Rested him then the great−hearted; the hall towered Roomy and gold−bright, the guest slept within. This rude energetic verse the Saxon scà ´p had sung to his harp or glee−beam, dwelling on the {15} emphatic syllables, passing swiftly over the others which were of undetermined number and position in the line. It was now displaced by the smooth metrical verse with rhymed endings, which the French introduced and which our modern poets use, a verse fitted to be recited rather than sung. The old English alliterative verse continued, indeed, in occasional use to the 16th century. But it was linked to a forgotten literature and an obsolete dialect, and was doomed to give way. Chaucer lent his great authority to the more modern verse system, and his own literary models and inspirers were all foreign, French or Italian. Literature in England began to be once more English and truly national in the hands of Chaucer and his contemporaries, but it was the literature of a nation cut off from its own past by three centuries of foreign rule. The most noteworthy English document of the 11th and 12th centuries was the continuation of the Anglo−Saxon chronicle. Copies of these annals, differing somewhat among themselves, had been kept at the monasteries in Winchester, Abingdon, Worcester, and elsewhere. The yearly entries were mostly brief, dry records of passing events, though occasionally they become full and animated. The fen country of Cambridge and Lincolnshire was a region of monasteries. Here were the great abbeys of Peterborough and Croyland and Ely minster. One of the earliest English songs tells how the savage heart of the Danish {16} king Cnut was softened by the singing of the monks in Ely. Merie sungen muneches binnen Ely Tha Cnut chyning reu ther by; Roweth, cnihtes, noer the land, And here we thes muneches sang. It was among the dikes and marshes of this fen country that the bold outlaw Hereward, â€Å"the last of the English,† held out for some years against the conqueror. And it was here, in the rich abbey of Burch or Peterborough, the ancient Medeshamstede (meadow−homestead) that the chronicle was continued for nearly a century after the Conquest, breaking off abruptly in 1154, the date of King Stephens death. Peterborough had received a new Norman abbot, Turold, â€Å"a very stern man,† and the entry in the chronicle for 1170 tells how Hereward and his gang, with his Danish backers, thereupon plundered the abbey of its treasures, which were first removed to Ely, and then carried off by the Danish fleet and sunk, lost, or squandered. The English in the later portions of this Peterborough chronicle becomes gradually more modern, and falls away more and more from the strict grammatical standards of the classical Anglo−Saxon. It is a most valuable historical monument, and some passages of it are written with great vividness, notably the sketch of William the Conqueror put down in the year of his death (1086) by one who had â€Å"looked upon him and at another time dwelt in his court.† {17} â€Å"He who was before a rich king, and lord of many a land, he had not then of all his land but a piece of seven feet. . . . Likewise he was a very stark man and a terrible, so that one durst do nothing against his will. . . . Among other things is not to be forgotten the good peace that he made in this land, so that a man might fare over his kingdom with his bosom full of gold unhurt. He set up a great deer preserve, and he laid laws therewith that whoso should slay hart or hind, he should be blinded. As greatly did he love the tall deer as if he were their father.† With the discontinuance of the Peterborough annals, English history written in English prose ceased for three hundred years. The thread of the nations story was kept up in Latin chronicles, compiled by writers partly of English and partly of Norman descent. The earliest of these, such as Ordericus Vitalis, Simeon ofDurham, Henry of Huntingdon, and William of Malmesbury, were contemporary with the later entries of the Saxon chronicle. The last of them, Matthew of Westminster, finished his work in 1273. About 1300 Robert, a monk of Gloucester, composed a chronicle in English verse, following in the main the authority of the Latin chronicles, and he was succeeded by other rhyming chroniclers in the 14th century. In the hands of these the true history of the Saxon times was overlaid with an ever−increasing mass of fable and legend. All real knowledge of the period {18} dwindled away until in Capgraves Chronicle of England, written in prose in 1463−64, hardly any thing of it is left. In history as in literature the English had forgotten their past, and had turned to foreign sources. It is noteworthy that Shakspere, who borrowed his subjects and his heroes sometimes from authentic English history, sometimes from the legendary history of ancient Britain, Denmark,and Scotland, as in Lear, Hamlet, and Macbeth, ignores the Saxon period altogether. And Spenser, who gives in his second book of the Faerie Queene, a resumà © of the reigns of fabulous British kings—the supposed ancestors of Queen Elizabeth, his royal patron—has nothing to say of the real kings of early England. So completely had the true record faded away that it made no appeal to the imaginations of our most patriotic poets. The Saxon Alfred had been dethroned by the British Arthur, and the conquered Welsh had imposed their fictitious genealogies upon the dynasty of the conquerors. In the Roman de Rou, a verse chronicle of the dukes of Normandy, written by the Norman Wace, it is related that at the battle of Hastings the French jongleur, Taillefer, spurred out before the van of Williams army, tossing his lance in the air and chanting of â€Å"Charlemagne and of Roland, of Oliver and the peers who died at Roncesvals.† This incident is prophetic of the victory which Norman song, no less than Norman arms, was to win over England. The lines which Taillefer {19} sang were from the Chanson de Roland, the oldest and best of the French hero sagas. The heathen Northmen, who had ravaged the coasts of France in the 10th century, had become in the course of one hundred and fifty years, completely identified with the French. They had accepted Christianity, intermarried with the native women, and forgotten their own Norse tongue. The race thus formed was the most brilliant in Europe. The warlike, adventurous spirit of the vikings mingled in its blood with the French nimbleness of wit and fondness for display. The Normans were a nation of knights−errant, with a passion for prowess and for courtesy. Their architecture was at once strong and graceful. Their women were skilled in embroidery, a splendid sample of which is preserved in the famous Bayeux tapestry, in which the conquerors wife, Matilda, and the ladies of her court wrought the history of the Conquest. This national taste for decoration expressed itself not only in the ceremonious pomp of feast and chase and tourney, but likewise in literature. The most characteristic contribution of the Normans to English poetry were the metrical romances or chivalry tales. These were sung or recited by the minstrels, who were among the retainers of every great feudal baron, or by the jongleurs, who wandered from court to castle. There is a whole literature of these romans d aventure in the Anglo−Norman dialect of French. Many of them are {20} very long—often thirty, forty, or fifty thousand lines—written sometimes in a strophic form, sometimes in long Alexandrines, but commonly in the short, eight−syllabled rhyming couplet. Numbers of them were turned into English verse in the 13th, 14th, and 15th centuries. The translations were usually inferior to the originals. The French trouvere (finder or poet) told his story in a straight−forward, prosaic fashion, omitting no details in the action and unrolling endless descriptions of dresses, trappings, gardens, etc. He invented plots and situations full of fine possibilities by which later poets have profited, but his own handling of them was feeble and prolix. Yet there was a simplicity about the old French language and a certain elegance and delicacy in the diction of the trouveres which the rude, unformed English failed to catch. The heroes of these romances were of various climes: Guy of Warwick, and Richard the Lion Heart of England, Havelok the Dane, Sir Troilus of Troy, Charlemagne, and Alexander. But, strangely enough, the favorite hero of English romance was that mythical Arthur of Britain, whom Welsh legend had celebrated as the most formidable enemy of the Sassenach invaders and their victor in twelve great battles. The language and literature of the ancient Cymry or Welsh had made no impression on their Anglo−Saxon conquerors. There are a few Welsh borrowings in the English speech, such as bard and druid; but in the old Anglo−Saxon literature there are {21} no more traces of British song and story than if the two races had been sundered by the ocean instead of being borderers for over six hundred years. But the Welsh had their own national traditions, and after the Norman Conquest these were set free from the isolation of their Celtic tongue and, in an indirect form, entered into the general literature of Europe. The French came into contact with the old British literature in two places: in the Welsh marches in England and in the province of Brittany in France, where the population is of Cymric race and spoke, and still to some extent speaks, a Cymric dialect akin to the Welsh. About 1140 Geoffrey of Monmouth, a Benedictine monk, seemingly of Welsh descent, who lived at the court of Henry the First and became afterward bishop of St. Asaph, produced in Latin a so−called Historia Britonum in which it was told how Brutus, the great grandson of Aeneas, came to Britain, and founded there his kingdom called after him, and his city of New Troy (Troynovant) on the site of the later London. An air of historic gravity was given to this tissue of Welsh legends by an exact chronology and the genealogy of theBritish kings, and the author referred, as his authority, to an imaginary Welsh book given him, as he said, by a certain Walter, archdeacon of Oxford. Here appeared that line of fabulous British princes which has become so familiar to modern readers in the plays of Shakspere and the poems of Tennyson: Lear and his {22} three daughters; Cymbeline, Gorboduc, the subject of the earliest regular English tragedy, composed by Sackville and acted in 1562; Locrine and his Queen Gwendolen, and his daughter Sabrina, who gave her name to the river Severn, was made immortal by an exquisite song in Miltons Comus, and became the heroine of the tragedy of Locrine, once attributed to Shakspere; and above all, Arthur, the son of Uther Pendragon, and the founder of the Table Round. In 1155 Wace, the author of the Roman de Rou, turned Geoffreys work into a French poem entitled Brut d Angleterre, â€Å"brut† being a Welsh word meaning chronicle. About the year 1200 Waces poem was Englished by Layamon, a priest of Arley Regis, on the border stream of Severn. Layamons Brut is in thirty thousand lines, partly alliterative and partly rhymed, but written in pure Saxon English with hardly any French words. The style is rude but vigorous, and, at times, highly imaginative. Wace had amplified Geoffreys chronicle somewhat, but Layamon made much larger additions, derived, no doubt, from legends current on the Welsh border. In particular the story of Arthur grew in his hands into something like fullness. He tells of the enchantments of Merlin, the wizard; of the unfaithfulness of Arthurs queen,Guenever; and the treachery of his nephew, Modred. His narration of the last great battle between Arthur and Modred; of the wounding of the king—â€Å"fifteen fiendly wounds he had, one might in the least {23} three gloves thrust—†; and of the little boat with â€Å"two women therein, wonderly dight,† which came to bear him away to Avalun and the Queen Argante, â€Å"sheenest of all elves,† whence he shall come again, according to Merlins prophecy, to rule the Britons; all this left little, in essentials, for Tennyson to add in his Death of Arthur. This new material for fiction was eagerly seized upon by the Norman romancers. The story of Arthur drew to itself other stories which were afloat.

Sunday, July 21, 2019

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

Saturday, July 20, 2019

The Puerto Rican Community in Hartford :: Culture Puerto Rico Spanish Essays

The Puerto Rican Community in Hartford Social Mobility is a hard term to define because it can be interpreted in an infinite amount of ways. My group has the responsibility of reporting how the Puerto Rican community in Hartford has evolved or changed in the past eighteen years. We are using a special section produced by the Hartford Current as our starting point. From there we are suppose to document how, if at all, the idea of transnational identity and mobility for Hartford’s Puerto Ricans has changed. I am writing about social mobility because my group is interested in knowing if in fact the idea of moving up on the social ladder is a motivation for Puerto Ricans to move to Hartford. Sal Enriquez has already shown that Puerto Ricans have moved to Hartford in the hopes of attaining economic success but what about social success? Before an answer can be provided I must try and define what social mobility is. In the context of this paper social mobility is the ability or opportunity for people within a certain to move up or down. I will assume that those that we are discussing are trying to move up, and not down in social class. It might be argued that social class ascension is directly related to economic success. If one wants to move up the social ladder then they first must move up the economic ladder. Since Puerto Ricans travel to the United States to attain economic stability are they also looking for social stability or improvement? There is no clear answer to this question. There are some Puerto Ricans in Hartford who have migrated so that they can maintain their social class standing. One student here at Trinity College is a good example of such mobility. Luigi Dessy a junior, engineering major, and active participant in school activities says that he came here for a good education and new experiences. He is appreciative of the fact that he has been able to attend private schools his whole life.

The Lesson and Mid-term Break Essay -- English Literature

Introduction to The Lesson and Mid-term Break "The Lesson" tells the story of a 10 year old boy who has lost his father in the duration of school time. It goes on the say he's trapped and although he feels grief for the death of his father he realises that he can use the death to "bind the bullies' fist". "Mid-Term Break" is about the loss of a brother. It goes on to say that life goes on even though he has lost his brother and he witnesses things he does not normally experience (his father crying). "Mid-Term Break" Meaning The meaning of "Mid-Term Break" is to tell the story of an accident involving a young child and a vehicle. He tries to explain how life goes on and the death of the boy's brother doesn't mean that life stops. It goes on to show that because his brother has died certain things happen that he doesn't usually see "I met my father crying" and " Old men standing up to shake my hand". It ends with the powerful and chilling line "a four foot box, a foot for every year" This shows that the boy was very young and had a small coffin because he was only 4 years of age. Structure The poems structure is very neat and very tidy. He chooses to write in three line stanzas because this allows the poem to flow easily and allows the stanza below it the link in with its predecessor. By also having three line stanzas helps the last line have more of a "punch" feeling because it breaks the mould. Heaney avoids using rhyme in this piece because we usually associate rhyme with happiness and glee. Because of this reason Heaney purposely makes this poem sad and hopeless. Analysing The mood changes throughout the poem. At the start the mood is sombre, sad and mysterious but when it reache... ...death. "Pride, like a goldfish, flashed a sudden fin": we can imagine the goldfish swimming in their bowl, perhaps set in the sunshine on a windowsill. The sun catches a goldfish at a certain angle, and the gold of its scales suddenly shines brightly. The speaker, caught in the sunshine of all this attention and sympathy, suddenly feels pride shining in him. At no point in this poem does the speaker express sadness at the loss of his father. However, he is aware that he should feel something, and his shame at the lack of feeling is in conflict with his relief and his pride. What is uppermost in the speaker's mind is the confined little world of the school (rather like the "shining prison" of the goldfish bowl). His life is centred on school, the bullying, his other school-mates. I think the bitter lesson he learns is about his own self-centredness.

Friday, July 19, 2019

Harrison Ainsworth Rookwood :: essays research papers

In the early nineteenth century, an interest in criminals and the common highwayman arose in Europe. Many magazines in London, such as Bentley’s Miscellany, Fraser’s Magazine, and The Athenaeum featured sections that were reserved for stories about highwayman and their numerous adventures. The growing interest in the subject inspired many authors to write about the various exploits of popular criminals and highwayman. Some prominent examples of this type of novel were Edward Bulwer’s Paul Clifford (1830) and Eugene Aram (1832); Charles Dickens’ Oliver Twist (1838-39) and Barnaby Rudge (1841); and William Harrison Ainsworth Rookwood (1834) and Jack Sheppard (1839-40). Several of these novels were based upon famous crimes and criminal careers of the past (Eugene Aram, Dick Turpin in Rookwood, and Jack Sheppard); others derived from contemporary crime (Altick, 1970, p. 72). Although many authors chose to base their stories on criminals, William Harrison Ainsworth’s Rookwood and Jack Sheppard are two of the best examples of the theme of ‘crime and punishment’ in the nineteenth century.   Ã‚  Ã‚  Ã‚  Ã‚  Ainsworth started his writing career as a writer of Gothic stories for various magazines. Gothic elements are included in Ainsworth’s novel: the ancient hall, the family vaults, macabre burial vaults, secret marriage, and so forth (John, 1998, p. 30). Rookwood is a story about two half-brothers in a conflict over the family inheritance. The English criminal who Ainsworth decides to entangle in Rookwood was Dick Turpin, a highwayman executed in 1739. However, echoing Bulwer, Ainsworth’s explanation for his interest in Dick Turpin (like Bulwer’s explanation in his choice of Eugene Aram as a subject) is personal and familial (John, 1998, p. 31). Though the basis of the novels seem similar, Ainsworth treated Dick Turpin in a different way than Bulwer treated Eugene Aram. Ainsworth romanticizes history, but basically sticks to the facts (as far as he knew them). Perhaps more importantly, Ainsworth does not pretend that the Turpin he invents is the real Dick Turpin, nor does he attempt to elevate Turpin’s social class status (John, 1998, p. 32). Ainsworth recalls lying in bed listening to the exploits of ‘Dauntless Dick’, as narrated by his father. Despite Ainsworth’s infatuation with the criminal, the real Turpin was no more interesting a character than an ordinary cat burglar. Besides highway robbery, his affairs included stealing sheep and breaking into farmer’ houses, sometimes with the aid of confederates; and he took a turn at smuggling (Hollingsworth, 1963, p. 99). Although Turpin appears in a considerable part of the novel, he really has no effect on the plot. He stole a marriage certificate, but the incident was not important

Thursday, July 18, 2019

Intimate Partner Violence Essay

Intimate partner violence is sometimes common in relationships, and many partners in the relationship, usually the male, will demonstrate acts of violence against his mate. There are various categories where violence falls, such as stalking, mental abuse, sexual abuse and physical abuse. We can find intimate partner violence in all groups of people which include, economic, social, ethnic, racial and many types of cultural group. Acts of violence can take place between one individual in the relationship or both. Usually there are links between intimate partner violence and different aspects that generally affect the relationship, where economic, psychological and social conditions contribute to the number of incidents reported to authorities. The impact of intimate partner violence varies, usually in the type and severity of abuse. Individuals who are vulnerable due to physical, psychological, economic, or social conditions or who have experienced prior victimization may be even more severely affected than those with financial resources, good health, favorable environments, and no other significant stressors or health problems. However, intimate violence can be traumatic for anyone. In some cases, the effects of prior intimate partner violence can be triggered for the first time or after a long period of remission months or years after the actual occurrence of violence has stopped. Intimate partner violence needs to be further investigated to find solutions. We learn from the Department of Justice Statistics Report, that â€Å"Statistics about intimate partner violence (IPV) vary because of differences in how different data sources define Intimate Partner Violence, (IPV). For example, some definitions include stalking and psychological abuse, and others consider only physical and sexual violence. Data on IPV usually come from police, clinical settings, nongovernmental organizations, and survey research. † There are many definitions of violence, and this is taken into consideration when statistics are completed. We also learn that, â€Å"Most IPV incidents are not reported to the police. About 20% of IPV rapes or sexual assaults, 25% of physical assaults, and 50% of stalkings directed toward women are reported. Even fewer IPV incidents against men are reported (Tjaden and Thoennes 2000a). Thus, it is believed that available data greatly underestimate the true magnitude of the problem. While not an exhaustive list, here are some statistics on the occurrence of IPV. In many cases, the severity of the IPV behaviors is unknown. † We are told by (Heise and Garcia Moreno, 2002) that, â€Å"Traditional gender norms (e. g. , women should stay at home and not enter workforce, should be submissive)† There are many males who often desire for their partners to stay out of the social and workforce realm and often violence is acted out toward spouses when they don’t give up any social attachments. Heise and Moreno tell us that, â€Å"Some factors that are common in intimate relationships that are violent include: 1. Couples with income, educational, or job status disparities 2. Dominance and control of the relationship by the male 3. Some community factors associated with intimate violence are: 4. Poverty and associated factors (e. g. , overcrowding) 5, Low social capital—lack of institutions, relationships, and norms that shape the 6. Quality and quantity of a community’s social interactions 7. Weak community sanctions against IPV (e. g. , police unwilling to intervene)† We learn from The Federal Government Source for Women‘s Health Information (womenshealth. gov. 2006) that, â€Å"One in four women report that they have been physically assaulted or raped by an intimate partner. These crimes occur in both heterosexual and same-sex relationships. Physical and emotional trauma can lead to increased stress, depression, lowered self-esteem and post-traumatic stress disorder (an emotional state of discomfort and stress connected to the memories of a disturbing event). † We also learn that, â€Å"Violence against women by anyone is always wrong, whether the abuser is a current or past spouse, boyfriend, or girlfriend; someone you date; a family member; an acquaintance; or a stranger. You are not at fault. You did not cause the abuse to happen, and you are not responsible for the violent behavior of someone else. † No matter who commits the violence in the relationship, (male or female), or the age of the victim in the intimate partnership, it is wrong. We also learn that, â€Å"Women of all ages are at risk for domestic and intimate partner violence and face similar challenges when trying to leave an abuser, like feelings of shame and money concerns. However, women who are 55 years and older and are abused face unique challenges. These women grew up and married during a time when domestic abuse was often ignored. Now, at an older age, they have endured many years of abuse and may have problems with poor self-image and shame. Older women who have been abused also are less likely to tell anyone about it; have health problems that keep them dependent on their abusive partner; feel committed to caring for their abusive aging partners; and are fearful of being alone. † We also learn from sources with the Department of Health and Human Resources that, â€Å"Many individuals who are abused in the relationship often stay because they feel obliged to stay out of loyalty or because of fear. Violence in the home doesn’t just affect the person being abused; it affects everyone in the home, including children. Children may witness abuse in a number of different ways. 1. They may be in the room and see their mother being abused. 2. They may hear their parents fighting. 3. They may see the aftermath of the abuse when they see their mother’s bruises. Studies have shown that children who grow up in violent homes are more likely to withdraw and have behavioral problems. As they get older, these children often blame themselves for not stopping the abuse. This can lead to further withdrawal, depression, and substance abuse. Children who grow up in abusive homes are more likely to become abusers or be abused themselves. A boy who grows up with a father who beats his mother tends to see women as weak and submissive and repeat the cycle of abuse in his own relationships. A girl who sees the abuse of her mother is likely to think that abuse is part of a normal relationship and become involved with an abuser herself. Intimate Partner Violence needs to be addressed. Too many individuals fall victim to this type of violence in a partnership and studies show that many factors contribute to this abuse. Many individuals who have never been in an abusive relationship wonder, â€Å"Why doesn’t she leave? † There are many reasons why individuals may not leave an abusive relationship. She may possess little or no money and have no way to ultimately support herself and her children or she may reach out for help only to find that all the local domestic violence shelters are full. She may not be able to contact friends and family who could help her. Or she may worry about the safety of herself and her children if she leaves. There must be resources for these individuals to turn to when violence is apparent in the intimate relationship. If you are being abused or have a loved one who is being abused, get help. Don’t ignore it. It won’t go away. Keep in mind, you’re not alone. Many women are victims of domestic abuse. There is help out there for victims of domestic abuse in intimate partner relationships. Contact your local women’s shelters in your area for advice and protection. Without help, abuse will continue and could worsen. Many resources are available to help you understand your options and to support you. No one deserves to be abused Typically each time the abuse occurs, it worsens, and the cycle shortens. Breaking this pattern of violence alone and without help is difficult. It’s always important to recognize that you may not be in a position to resolve the situation on your own. You may need outside help, and that’s OK. Without help, the abuse will likely continue. Leaving the abusive relationship may be the only way to break the cycle. Reference Page Heise, L, Garcia-Moreno. (2002) †Violence Against Intimate Partners†. World Report on Violence and Health. P. 87-121 The Department of Health & Human Services. (2006). â€Å"Violence Against Women†. womens health. gov. Tjaden, Thoennes P. (2000). â€Å"Full Report: Violence Against Women Report†. Department of Justice.